pEGFP-N1-delta30-TFEB
(Plasmid #44445)

• Depositing Lab: Shawn Ferguson
• Publication: Roczniak-Ferguson et al Sci Signal. 2012 Jun 12;5(228):ra42.

Backbone

• Vector backbone: pEGFP-N1
• Backbone manufacturer: Glontech
• Backbone size w/o insert (bp): 4733
• Total vector size (bp): 6061
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: TFEB
• Species: H. sapiens (human)
• Insert Size (bp): 1321
• Mutation: Deleted amino acids 1-30; H32D
• Entrez Gene: TFEB (a.k.a. ALPHATFEB, BHLHE35, TCFEB)
• Tag / Fusion Protein:
  • GFP (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindIII (not destroyed)
• 3′ cloning site: KpnI (not destroyed)
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: CGTCGCCGTCCAGCTCGACCAG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Andrea Ballabio, TIGEM, Naples, Italy
• Articles Citing this Plasmid:
  • 5 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The first 30 amino acids of the TFEB insert (up to M31) were deleted. In order to create an optimal Kozak sequence at the new start site (M31), an additional mutation was introduced that changed the second amino acid from H to D (H32D mutation relative to the wild-type sequence).