pIC194
(Plasmid
#44433)
-
Purpose(Empty Backbone)
-
Depositing Labs
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 44433 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepBabe
- Backbone size (bp) 4850
-
Modifications to backbonemCherry sequence
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersNeomycin (select with G418)
-
Tags
/ Fusion Proteins
- mcherry (N terminal on backbone)
- tev (N terminal on insert)
- s peptide (N terminal on insert)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer GGCATGGACGAGCTGTACAAG
- 3′ sequencing primer GCATTCATTTTATGTTTCAGG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pIC194 was a gift from Iain Cheeseman & Arshad Desai (Addgene plasmid # 44433 ; http://n2t.net/addgene:44433 ; RRID:Addgene_44433) -
For your References section:
A combined approach for the localization and tandem affinity purification of protein complexes from metazoans. Cheeseman IM, Desai A. Sci STKE. 2005 Jan 11;2005(266):pl1. 10.1126/stke.2662005pl1 PubMed 15644491