Skip to main content
Addgene

pIC194
(Plasmid #44433)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 44433 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pBabe
  • Backbone size (bp) 4850
  • Modifications to backbone
    mCherry sequence
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Neomycin (select with G418)
  • Tags / Fusion Proteins
    • mcherry (N terminal on backbone)
    • tev (N terminal on insert)
    • s peptide (N terminal on insert)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer GGCATGGACGAGCTGTACAAG
  • 3′ sequencing primer GCATTCATTTTATGTTTCAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pIC194 was a gift from Iain Cheeseman & Arshad Desai (Addgene plasmid # 44433 ; http://n2t.net/addgene:44433 ; RRID:Addgene_44433)
  • For your References section:

    A combined approach for the localization and tandem affinity purification of protein complexes from metazoans. Cheeseman IM, Desai A. Sci STKE. 2005 Jan 11;2005(266):pl1. 10.1126/stke.2662005pl1 PubMed 15644491