pIC242
(Plasmid
#44432)
-
Depositing Labs
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 44432 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepBabe
- Backbone size w/o insert (bp) 6000
- Total vector size (bp) 6672
-
Modifications to backboneThe plasmid contains a blasticidin resistant gene for selection in eukaryotic cells.
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMob1A
-
SpeciesH. sapiens (human)
-
Insert Size (bp)700
-
MutationF5L, K15R and G212R
-
Entrez GeneMOB1A (a.k.a. C2orf6, MATS1, MOB1, MOBK1B, MOBKL1B, Mob4B)
-
Tags
/ Fusion Proteins
- GFP (N terminal on backbone)
- tev (N terminal on insert)
- s peptide (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site SacII/EcoRI (not destroyed)
- 5′ sequencing primer GGCATGGACGAGCTGTACAAG
- 3′ sequencing primer GCATTCATTTTATGTTTCAGG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
F5L, K15R and G212R mutations in Mob1A when compared to GenBank reference sequence NM_018221.3
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pIC242 was a gift from Iain Cheeseman & Arshad Desai (Addgene plasmid # 44432 ; http://n2t.net/addgene:44432 ; RRID:Addgene_44432) -
For your References section:
A combined approach for the localization and tandem affinity purification of protein complexes from metazoans. Cheeseman IM, Desai A. Sci STKE. 2005 Jan 11;2005(266):pl1. 10.1126/stke.2662005pl1 PubMed 15644491