pIC242
(Plasmid #44432)

• Depositing Labs: Iain Cheeseman, Arshad Desai
• Publication: Cheeseman et al Sci STKE. 2005 Jan 11;2005(266):pl1.

Backbone

• Vector backbone: pBabe
• Backbone size w/o insert (bp): 6000
• Total vector size (bp): 6672
• Modifications to backbone: The plasmid contains a blasticidin resistant gene for selection in eukaryotic cells.
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Mob1A
• Species: H. sapiens (human)
• Insert Size (bp): 700
• Mutation: F5L, K15R and G212R
• Entrez Gene: MOB1A (a.k.a. C2orf6, MATS1, MOB1, MOBK1B, MOBKL1B, Mob4B)
• Tags / Fusion Proteins:
  • GFP (N terminal on backbone)
  • tev (N terminal on insert)
  • s peptide (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: SacII/EcoRI (not destroyed)
• 5′ sequencing primer: GGCATGGACGAGCTGTACAAG
• 3′ sequencing primer: GCATTCATTTTATGTTTCAGG

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

F5L, K15R and G212R mutations in Mob1A when compared to GenBank reference sequence NM_018221.3