Skip to main content
Addgene

pINDUCER11 (miR-RUG)
(Plasmid #44363)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 44363 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    GIPZ
  • Backbone manufacturer
    Open Biosystems
  • Backbone size w/o insert (bp) 11688
  • Total vector size (bp) 14699
  • Modifications to backbone
    pINDUCER11 (miR-RUG) was made by first digesting pINDUCER10 with XbaI and PacI to remove the rtTA through the puromycin resistance gene. The rtTAIRES segment was removed from pIndmir3Luc-miR by XbaI and NotI digest. eGFP was PCR amplified from MSCV-N-eGFP-ENTR using primers 5′-TAATACATGT ATCGATCCACCATGGTGAGCAAGGGC and 5′-GATCTTAATTAA TTACTTGTACAGCTCGTCCATGCCG. The PCR product was digested with PciI and PacI. The vector, rtTA-IRES, and eGFP were then ligated and sequence verified.
  • Vector type
    Lentiviral
  • Selectable markers
    EGFP; RFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PheS Gly294
  • gRNA/shRNA sequence
    mir30
  • Species
    P. haloplanktis

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pINDUCER11 (miR-RUG) was a gift from Thomas Westbrook (Addgene plasmid # 44363 ; http://n2t.net/addgene:44363 ; RRID:Addgene_44363)
  • For your References section:

    The pINDUCER lentiviral toolkit for inducible RNA interference in vitro and in vivo. Meerbrey KL, Hu G, Kessler JD, Roarty K, Li MZ, Fang JE, Herschkowitz JI, Burrows AE, Ciccia A, Sun T, Schmitt EM, Bernardi RJ, Fu X, Bland CS, Cooper TA, Schiff R, Rosen JM, Westbrook TF, Elledge SJ. Proc Natl Acad Sci U S A. 2011 Mar 1;108(9):3665-70. doi: 10.1073/pnas.1019736108. Epub 2011 Feb 9. 10.1073/pnas.1019736108 PubMed 21307310