Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pMX_mTAF3
(Plasmid #44334)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 44334 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pMX
  • Total vector size (bp) 7459
  • Vector type
    Mammalian Expression, Retroviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Growth instructions
    Standard
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    TAF3
  • Alt name
    TBP-associated factor 3
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    2797
  • GenBank ID
    NM_027748.3
  • Entrez Gene
    Taf3 (a.k.a. 140kDa, 4933439M23Rik, AW539625, TAF140, TAFII-140, TAFII140, mTAFII140)
  • Promoter LTR
  • Tag / Fusion Protein
    • Flag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoR1 (not destroyed)
  • 3′ cloning site Xho1 (not destroyed)
  • 5′ sequencing primer TACACGCCGCCCACGTGAAGGC
  • 3′ sequencing primer unknown
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Taken from: pxj4l-mTAF3-flag (Gangloff et al., MCB 21: 5109 (2001)) Kindly provided by drs. Mengus and Davidson

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMX_mTAF3 was a gift from Marc Timmers (Addgene plasmid # 44334 ; http://n2t.net/addgene:44334 ; RRID:Addgene_44334)
  • For your References section:

    A central role for TFIID in the pluripotent transcription circuitry. Pijnappel WW, Esch D, Baltissen MP, Wu G, Mischerikow N, Bergsma AJ, van der Wal E, Han DW, Bruch Hv, Moritz S, Lijnzaad P, Altelaar AF, Sameith K, Zaehres H, Heck AJ, Holstege FC, Scholer HR, Timmers HT. Nature. 2013 Mar 28;495(7442):516-9. doi: 10.1038/nature11970. Epub 2013 Mar 17. 10.1038/nature11970 PubMed 23503660