Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCIG-Flag-Sox9-IRES-nls-GFP
(Plasmid #44281)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 44281 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCIG
  • Backbone manufacturer
    Sean Megason and Andrew McMahon
  • Backbone size w/o insert (bp) 6240
  • Total vector size (bp) 7740
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Flag-Sox9
  • Species
    G. gallus (chicken)
  • Insert Size (bp)
    1500
  • GenBank ID
    AB012236.1
  • Entrez Gene
    SOX9 (a.k.a. SOX-9)
  • Promoter CMV-IE enhancer and Chicken beta-actin promoter
  • Tag / Fusion Protein
    • Flag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRV (destroyed during cloning)
  • 3′ cloning site EcoRV (destroyed during cloning)
  • 5′ sequencing primer tacagctcctgggcaacgtg
  • 3′ sequencing primer gcttcggccagtaacgttag
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCIG-Flag-Sox9-IRES-nls-GFP was a gift from Martin Cheung (Addgene plasmid # 44281 ; http://n2t.net/addgene:44281 ; RRID:Addgene_44281)
  • For your References section:

    Phosphorylation of Sox9 is required for neural crest delamination and is regulated downstream of BMP and canonical Wnt signaling. Liu JA, Wu MH, Yan CH, Chau BK, So H, Ng A, Chan A, Cheah KS, Briscoe J, Cheung M. Proc Natl Acad Sci U S A. 2013 Feb 19;110(8):2882-7. doi: 10.1073/pnas.1211747110. Epub 2013 Feb 4. 10.1073/pnas.1211747110 PubMed 23382206