K15-EGFP
(Plasmid #44266)

• Depositing Lab: George Cotsarelis
• Publication: Morris et al Nat Biotechnol. 2004 Apr;22(4):411-7. Epub 2004 Mar 14.

Backbone

• Vector backbone: pEGFP-N2
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 4737
• Total vector size (bp): 9872
• Modifications to backbone: CMV promoter replaced with murine K15 promoter (-4.8) fragment
• Vector type: Mammalian Expression, Mouse Targeting ; Fluorescence microscopy
• Selectable markers: Neomycin (select with G418) ; EGFP

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: K15 promoter (-4.8)
• Alt name: Krt1-15 promoter
• Alt name: mouse keratin 15 promoter
• Alt name: Krt15 keratin 15
• Species: M. musculus (mouse)
• Insert Size (bp): 4961
• Mutation: Contains the murine K15 promoter (-4.8) fragment
• GenBank ID: NC_000077.6 AF542050
• Entrez Gene: Krt15 (a.k.a. RP23-217I3.2, AI528832, K15, Krt1-15)
• Promoter: murine K15 promoter (-4.8) fragment
• Tag / Fusion Protein:
  • EGFP (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: pBR322ori-F
• 3′ sequencing primer: EGFP-N; SV40-pA-R

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Alternate plasmid name: pEGFP-N2 K15

The K15 promoter was cloned from C57 BL/SJ mouse genomic DNA (isolated from tail) by PCR using the Supermix High Fidelity Kit (GIBCO). The sequences of the forward and reverse primers were

CTGAGCTACCAGCGAGACTCC (K15F1)
and
TTCCTGTCCCTAGCAAGCAGGAGAG (K15R1),

respectively. XhoI and EcoRI restriction sequences were added to the 5' end of forward and reverse primers respectively for subsequent cloning of the PCR product into PBK/CMV vector (Stratagene). The promoter fragment was then subcloned into pGEGFP-N2

The entire K15 promoter-EGFP transgene can be released by digestion with XhoI/AflII.