pECFP(C1)-PP1gamma
(Plasmid
#44232)
-
Depositing Labs
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 44232 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepECFP-C1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4700
- Total vector size (bp) 5672
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePP-1G
-
Alt namePPP1CC
-
Alt namePPP1CC protein phosphatase 1, catalytic subunit, gamma isozyme
-
SpeciesH. sapiens (human)
-
Insert Size (bp)972
-
GenBank IDNM_002710
-
Entrez GenePPP1CC (a.k.a. PP-1G, PP1C, PPP1G)
- Promoter CMV
-
Tag
/ Fusion Protein
- CFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (unknown if destroyed)
- 3′ cloning site SalI (unknown if destroyed)
- 5′ sequencing primer TGGTCCTGCTGGAGTTCGTGACC
- 3′ sequencing primer GTTTGGACAAACCACAACTAGAATGCAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that there is a silent mutation at bp#784 when compared to GenBank reference sequence NM_002710.3.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pECFP(C1)-PP1gamma was a gift from Angus Lamond & Laura Trinkle-Mulcahy (Addgene plasmid # 44232 ; http://n2t.net/addgene:44232 ; RRID:Addgene_44232) -
For your References section:
Dynamic targeting of protein phosphatase 1 within the nuclei of living mammalian cells. Trinkle-Mulcahy L, Sleeman JE, Lamond AI. J Cell Sci. 2001 Dec;114(Pt 23):4219-28. PubMed 11739654