pEGFP(C1)-PP1gamma
(Plasmid #44225)

• Depositing Labs: Angus Lamond, Laura Trinkle-Mulcahy
• Publication: Trinkle-Mulcahy et al J Cell Sci. 2001 Dec;114(Pt 23):4219-28.

Backbone

• Vector backbone: pEGFP-C1
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 4700
• Total vector size (bp): 5672
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: PP-1G
• Alt name: PPP1CC
• Alt name: PPP1CC protein phosphatase 1, catalytic subunit, gamma isozyme
• Species: H. sapiens (human)
• Insert Size (bp): 972
• GenBank ID: NM_002710
• Entrez Gene: PPP1CC (a.k.a. PP-1G, PP1C, PPP1G)
• Promoter: CMV
• Tag / Fusion Protein:
  • GFP (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (unknown if destroyed)
• 3′ cloning site: SalI (unknown if destroyed)
• 5′ sequencing primer: TGGTCCTGCTGGAGTTCGTGACC
• 3′ sequencing primer: GTTTGGACAAACCACAACTAGAATGCAG

Resource Information

• Articles Citing this Plasmid:
  • 5 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note that there is a silent mutation at bp#784 when compared to GenBank reference sequence NM_002710.3.