pEGFP(N3)-PP1beta
(Plasmid #44223)

• Depositing Labs: Angus Lamond, Laura Trinkle-Mulcahy
• Publication: Trinkle-Mulcahy et al J Cell Sci. 2001 Dec;114(Pt 23):4219-28.

Backbone

• Vector backbone: pEGFP-N3
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 4700
• Total vector size (bp): 5684
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: PP1B
• Alt name: PPP1CB
• Alt name: PPP1CB protein phosphatase 1, catalytic subunit, beta isozyme
• Species: H. sapiens (human)
• Insert Size (bp): 984
• GenBank ID: NM_002709
• Entrez Gene: PPP1CB (a.k.a. HEL-S-80p, MP, NSLH2, PP-1B, PP1B, PP1beta, PP1c, PPP1CD, PPP1beta)
• Promoter: CMV
• Tag / Fusion Protein:
  • GFP (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (unknown if destroyed)
• 3′ cloning site: PstI (unknown if destroyed)
• 5′ sequencing primer: gtacatcaatgggcgtggatag
• 3′ sequencing primer: gtggtgcagatgaacttcag

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note that there is a silent mutation at bp#842 when compared to GenBank reference sequence NM_002709.2.