N163 nLV EF-1a-Hp1a(CS)-Frbx2(Frb+FrbWobb)-V5-PGK-Puro
(Plasmid
#44195)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 44195 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneN103
- Backbone size w/o insert (bp) 8600
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCbx5
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)357
-
MutationN-term chromo domain removed
-
Entrez GeneCbx5 (a.k.a. 2610029O15Rik, HP1, Hp1a, Hp1alpha)
- Promoter EF-1a
-
Tags
/ Fusion Proteins
- Frb (C terminal on insert)
- Hu Frb x2(WT Frb+codon Wobble Frb) (C terminal on insert)
- V5/epitope (C terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer GGCACTTGATGTAATTCTCCTTG
- 3′ sequencing primer gtggatgtggaatgtgtgcga (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
N163 nLV EF-1a-Hp1a(CS)-Frbx2(Frb+FrbWobb)-V5-PGK-Puro was a gift from Jerry Crabtree (Addgene plasmid # 44195 ; http://n2t.net/addgene:44195 ; RRID:Addgene_44195) -
For your References section:
Dynamics and memory of heterochromatin in living cells. Hathaway NA, Bell O, Hodges C, Miller EL, Neel DS, Crabtree GR. Cell. 2012 Jun 22;149(7):1447-60. doi: 10.1016/j.cell.2012.03.052. Epub 2012 Jun 14. 10.1016/j.cell.2012.03.052 PubMed 22704655