p6721 MSCV-IP N FlagHA 16E6 8S9A10T
(Plasmid
#44153)
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 44153 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneMSCV-IP N-FlagHA
- Backbone size w/o insert (bp) 8100
- Total vector size (bp) 8600
-
Modifications to backboneRetroviral vector for Flag-HA-tagged HPV16 E6 8S9A10T mutant expression (deficient in p53 binding). No starting ATG in viral ORF, translation begins from tag only. Puro resistance protein expressed from an IRES.
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameHPV16E6
-
SpeciesHPV16
-
Insert Size (bp)500
-
MutationE6 8S9A10T mutant
- Promoter MSCV LTR
-
Tags
/ Fusion Proteins
- Flag (N terminal on backbone)
- HA (N terminal on backbone)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer 5' CTACATCGTGACCTGGGAAGC 3' (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byPaul Lambert - University of Wisconsin, Madison
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p6721 MSCV-IP N FlagHA 16E6 8S9A10T was a gift from Peter Howley (Addgene plasmid # 44153 ; http://n2t.net/addgene:44153 ; RRID:Addgene_44153) -
For your References section:
Comprehensive analysis of host cellular interactions with human papillomavirus E6 proteins identifies new E6 binding partners and reflects viral diversity. White EA, Kramer RE, Tan MJ, Hayes SD, Harper JW, Howley PM. J Virol. 2012 Dec;86(24):13174-86. doi: 10.1128/JVI.02172-12. Epub 2012 Sep 26. 10.1128/JVI.02172-12 PubMed 23015706