p6659 MSCV-IP N FlagHA HPV16E6
(Plasmid #44152)

• Depositing Lab: Peter Howley
• Publication: White et al J Virol. 2012 Dec;86(24):13174-86. doi: 10.1128/JVI.02172-12. Epub 2012 Sep 26.

Backbone

• Vector backbone: MSCV-IP N-FlagHA
• Backbone size w/o insert (bp): 8100
• Total vector size (bp): 8600
• Modifications to backbone: Retroviral vector for Flag-HA-tagged HPV16 E6 expression. No starting ATG in viral ORF, translation begins from tag only. Puro resistance protein expressed from an IRES.
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: HPV16E6
• Species: HPV16
• Insert Size (bp): 500
• Promoter: MSCV LTR
• Tags / Fusion Proteins:
  • Flag (N terminal on backbone)
  • HA (N terminal on backbone)

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: 5' CTACATCGTGACCTGGGAAGC 3'

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Paul Lambert - University of Wisconsin, Madison
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry