pCR2.1-ZFpparg
(Plasmid
#44151)
-
PurposeThis is intended for use in riboprobe synthesis, not for cloning.
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 44151 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCR2.1-TOPO
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 3900
- Total vector size (bp) 4659
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsAlso Amp resistant
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePeroxisome proliferator-activated receptor gamma
-
Alt namepparg
-
SpeciesD. rerio (zebrafish)
-
Insert Size (bp)759
Cloning Information
- Cloning method TOPO Cloning
- 5′ sequencing primer GAAGATCCGTCTTCATCCTCAC
- 3′ sequencing primer GATCTGTCCGTAGGAGATCAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Note from the depositor:This is intended for use in riboprobe synthesis, not for cloning.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCR2.1-ZFpparg was a gift from John Rawls (Addgene plasmid # 44151 ; http://n2t.net/addgene:44151 ; RRID:Addgene_44151) -
For your References section:
Ontogeny and nutritional control of adipogenesis in zebrafish (Danio rerio). Flynn EJ 3rd, Trent CM, Rawls JF. J Lipid Res. 2009 Aug;50(8):1641-52. doi: 10.1194/jlr.M800590-JLR200. Epub 2009 Apr 14. 10.1194/jlr.M800590-JLR200 PubMed 19366995