p6664 MSCV-IP N-HAonly 45E6
(Plasmid #44138)

• Depositing Lab: Peter Howley
• Publication: White et al J Virol. 2012 Dec;86(24):13174-86. doi: 10.1128/JVI.02172-12. Epub 2012 Sep 26.

Backbone

• Vector backbone: MSCV-IP N-HAonly
• Backbone size w/o insert (bp): 8100
• Total vector size (bp): 8600
• Modifications to backbone: Retroviral vector for HA-tagged HPV45 E6 expression. No starting ATG in viral ORF, translation begins from tag only. Puro resistance protein expressed from an IRES.
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: HPV45 E6
• Species: HPV45
• Insert Size (bp): 500
• Promoter: MSCV LTR
• Tag / Fusion Protein:
  • HA (N terminal on backbone)

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: 5' CTACATCGTGACCTGGGAAGC 3'

Resource Information

• A portion of this plasmid was derived from a plasmid made by: From DKFZ.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

DKFZ is the co-provider of this plasmid.