pimEJ5GFP
(Plasmid #44026)

• Depositing Lab: Jeremy Stark
• Publication: Bennardo et al PLoS Genet. 2008 Jun 27;4(6):e1000110. doi: 10.1371/journal.pgen.1000110.

Backbone

• Vector backbone: p59 pim targeting vector
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: EJ5GFP egfp-based chromosomal break reporter
• Species: Synthetic
• Mutation: pCAGGS promoter and eGFP separated by pgkPURO cassette flanked by two I-SceI sites
• GenBank ID: U55761.1
• Promoter: pCAGGS

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: ttcctacagctcctgggcaacg
• 3′ sequencing primer: ttttggcagagggaaaaaga

Resource Information

• Articles Citing this Plasmid:
  • 65 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Reporter for NHEJ. I-SceI-based chromosomal break reporter for end joining. End joining between two distal tandem I-SceI recognition sites restores an eGFP expression cassette, causing deletion of the intervening pgkPURO cassette. Linearize with XhoI for integration into any mammalian cell type. Also contains a promoter-less HYG gene and targeting arms to select for targeted integration to the mouse pim1 locus.