-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 44025 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepgkPURO
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameEJ2GFP egfp-based chromosomal break reporter
-
SpeciesSynthetic
-
Mutationinsertion of I-SceI, 3 frame stop, and flanking microhomology
-
GenBank IDU55761.1
- Promoter pCAGGS
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer ttcctacagctcctgggcaacg
- 3′ sequencing primer ttttggcagagggaaaaaga (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
I-SceI-based chromosomal break reporter for Alt-EJ / MMEJ. Repair of an I-SceI-induced chromosomal break by Alt-EJ restores a GFP expression cassette. Linearize with HpaI for chromosomal integration.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
EJ2GFP-puro was a gift from Jeremy Stark (Addgene plasmid # 44025 ; http://n2t.net/addgene:44025 ; RRID:Addgene_44025) -
For your References section:
Alternative-NHEJ is a mechanistically distinct pathway of mammalian chromosome break repair. Bennardo N, Cheng A, Huang N, Stark JM. PLoS Genet. 2008 Jun 27;4(6):e1000110. doi: 10.1371/journal.pgen.1000110. 10.1371/journal.pgen.1000110 PubMed 18584027