Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

EJ2GFP-puro
(Plasmid #44025)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 44025 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pgkPURO
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    EJ2GFP egfp-based chromosomal break reporter
  • Species
    Synthetic
  • Mutation
    insertion of I-SceI, 3 frame stop, and flanking microhomology
  • GenBank ID
    U55761.1
  • Promoter pCAGGS

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer ttcctacagctcctgggcaacg
  • 3′ sequencing primer ttttggcagagggaaaaaga
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

I-SceI-based chromosomal break reporter for Alt-EJ / MMEJ. Repair of an I-SceI-induced chromosomal break by Alt-EJ restores a GFP expression cassette. Linearize with HpaI for chromosomal integration.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    EJ2GFP-puro was a gift from Jeremy Stark (Addgene plasmid # 44025 ; http://n2t.net/addgene:44025 ; RRID:Addgene_44025)
  • For your References section:

    Alternative-NHEJ is a mechanistically distinct pathway of mammalian chromosome break repair. Bennardo N, Cheng A, Huang N, Stark JM. PLoS Genet. 2008 Jun 27;4(6):e1000110. doi: 10.1371/journal.pgen.1000110. 10.1371/journal.pgen.1000110 PubMed 18584027