N205 nLV EF-1a-ZFHD1-link-FKBP-HA <T2A> HP1aCS-Frbx2-V5-PGK-Blast
(Plasmid #44017)

• Depositing Lab: Jerry Crabtree
• Publication: Hathaway et al Cell. 2012 Jun 22;149(7):1447-60. doi: 10.1016/j.cell.2012.03.052. Epub 2012 Jun 14.

Backbone

• Vector backbone: N103
• Backbone size w/o insert (bp): 8600
• Vector type: Lentiviral
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: FKBP
• Species: H. sapiens (human)
• Insert Size (bp): 321
• Promoter: EF-1a
• Tags / Fusion Proteins:
  • HA (C terminal on insert)
  • ZFHD1 (N terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: GGCACTTGATGTAATTCTCCTTG
• 3′ sequencing primer: gtggatgtggaatgtgtgcga

Gene/Insert 2

• Gene/Insert name: Cbx5
• Species: M. musculus (mouse)
• Insert Size (bp): 357
• Mutation: N-term chromo domain removed
• Entrez Gene: Cbx5 (a.k.a. 2610029O15Rik, HP1, Hp1a, Hp1alpha)
• Promoter: EF-1a
• Tags / Fusion Proteins:
  • Frb (C terminal on insert)
  • Hu Frb x2(WT Frb+codon Wobble Frb) (C terminal on insert)
  • V5/epitope (C terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: GGCACTTGATGTAATTCTCCTTG
• 3′ sequencing primer: gtggatgtggaatgtgtgcga

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry