pCoofy27
(Plasmid #44003)

• Purpose: (Empty Backbone)
• Depositing Lab: Sabine Suppmann
• Publication: Scholz et al BMC Biotechnol. 2013 Feb 14;13(1):12.

Backbone

• Vector backbone: pFastBac
• Backbone manufacturer: Life Technologies
• Backbone size (bp): 5214
• Modifications to backbone: insertion of Llp-ccdB
• Vector type: Insect Expression
• Promoter: PPH
• Tag / Fusion Protein:
  • His6 (N terminal on backbone)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DB3.1
• Growth instructions: ccdB Survival cells are NOT suitable for the unmodified plasmid containing the ccdB gene. The plasmid is provided in the recommended DB3.1 strain.
• Copy number: High Copy

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: 5`ATTAAAATGATAACCATCTCG 3
• 3′ sequencing primer: 5`TGTTTCAGGTTCAGGGGGAGGTGT 3`

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Test each preparation of the plasmid by transforming it into non-resistant cells (ex. DH5a) to ensure negative selection by ccdB kills all the transformed cells as expected.