pCoofy24
(Plasmid #43995)

• Purpose: (Empty Backbone)
• Depositing Lab: Sabine Suppmann
• Publication: Scholz et al BMC Biotechnol. 2013 Feb 14;13(1):12.

Backbone

• Vector backbone: pET, pCoofy19
• Backbone manufacturer: Novagen
• Backbone size (bp): 5806
• Modifications to backbone: Insertion of Llp-ccdB
• Vector type: Bacterial Expression
• Promoter: T7
• Tags / Fusion Proteins:
  • CBP (N terminal on backbone)
  • His10 (C terminal on backbone)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DB3.1
• Growth instructions: ccdB Survival cells are NOT suitable for the unmodified plasmid containing the ccdB gene. The plasmid is provided in the recommended DB3.1 strain.
• Copy number: Low Copy

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: 5' TAATACGACTCACTATAGGG 3'
• 3′ sequencing primer: 5' GCTAGTTATTGCTCAGCGG 3'

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Test each preparation of the plasmid by transforming it into non-resistant cells (ex. DH5a) to ensure negative selection by ccdB kills all the transformed cells as expected.