pCoofy18
(Plasmid #43975)

• Purpose: (Empty Backbone)
• Depositing Lab: Sabine Suppmann
• Publication: Scholz et al BMC Biotechnol. 2013 Feb 14;13(1):12.

Backbone

• Vector backbone: pET, pCoofy1
• Backbone manufacturer: Novagen
• Backbone size (bp): 5749
• Modifications to backbone: Insertion of Llp-ccdB
• Vector type: Bacterial Expression
• Promoter: T7
• Tag / Fusion Protein:
  • His10 (N terminal on backbone)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DB3.1
• Growth instructions: ccdB Survival cells are NOT suitable for the unmodified plasmid containing the ccdB gene. The plasmid is provided in the recommended DB3.1 strain.
• Copy number: Low Copy

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: 5' TAATACGACTCACTATAGGG 3'
• 3′ sequencing primer: 5' GCTAGTTATTGCTCAGCGG 3'

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Test each preparation of the plasmid by transforming it into non-resistant cells (ex. DH5a) to ensure negative selection by ccdB kills all the transformed cells as expected.

Note that depending on the protein, the 10x His tag can reduce or abolish expression.