pFS337-USP44-FLAG
(Plasmid
#43905)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 43905 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonep332
- Backbone size w/o insert (bp) 9692
-
Vector typeInsect Expression ; baculoviral expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameUSP44
-
Alt nameHGNC:20064
-
SpeciesH. sapiens (human)
-
Entrez GeneUSP44
-
Tag
/ Fusion Protein
- FLAG (N terminal on backbone)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer GGCACCTCGATTAGTTCTCGAGC
- 3′ sequencing primer AATCCAGAGGTTGATTATCG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFS337-USP44-FLAG was a gift from Stephen Elledge (Addgene plasmid # 43905 ; http://n2t.net/addgene:43905 ; RRID:Addgene_43905) -
For your References section:
Anaphase initiation is regulated by antagonistic ubiquitination and deubiquitination activities. Stegmeier F, Rape M, Draviam VM, Nalepa G, Sowa ME, Ang XL, McDonald ER 3rd, Li MZ, Hannon GJ, Sorger PK, Kirschner MW, Harper JW, Elledge SJ. Nature. 2007 Apr 19;446(7138):876-81. 10.1038/nature05694 PubMed 17443180