pcDNA-TAL-NC2
(Plasmid
#43855)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 43855 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepcDNA3.1
-
Backbone manufacturerInvitrogen
- Total vector size (bp) 7152
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTALEN-FokI nuclease backbone
-
SpeciesXanthamonas oryzae
-
Tags
/ Fusion Proteins
- FokI nuclease (C terminal on insert)
- Flag (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer ccactgcttactggcttatcgaa (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
For more information on Yamamoto TALEN Add-On Plasmids please refer to: http://www.addgene.org/TALEN/Yamamotolab/
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA-TAL-NC2 was a gift from Takashi Yamamoto (Addgene plasmid # 43855 ; http://n2t.net/addgene:43855 ; RRID:Addgene_43855) -
For your References section:
Efficient TALEN construction and evaluation methods for human cell and animal applications. Sakuma T, Hosoi S, Woltjen K, Suzuki KI, Kashiwagi K, Wada H, Ochiai H, Miyamoto T, Kawai N, Sasakura Y, Matsuura S, Okada Y, Kawahara A, Hayashi S, Yamamoto T. Genes Cells. 2013 Feb 6. doi: 10.1111/gtc.12037. 10.1111/gtc.12037 PubMed 23388034