pHes1(467 RBPj(-))-luc
(Plasmid #43805)

• Depositing Lab: Ryoichiro Kageyama
• Publication: Nishimura et al Genomics. 1998 Apr 1;49(1):69-75.

Backbone

• Vector backbone: pGL2-Basic
• Backbone manufacturer: Promega
• Backbone size w/o insert (bp): 5597
• Total vector size (bp): 6110
• Vector type: Mammalian Expression, Luciferase

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Hes1 Promoter (-467 to +46) RBPj(-)
• Alt name: Hes1
• Alt name: hairy and enhancer of split 1 Promoter (-467 to +46) RBPj(-)
• Alt name: hairy and enhancer of split 1
• Species: M. musculus (mouse)
• Insert Size (bp): 513
• Mutation: Contains the murine Hes1 promoter (-467 to +46), lacks the RBP-J site (see below)
• GenBank ID: NC_000082.6
• Entrez Gene: Hes1 (a.k.a. Hry, bHLHb39)
• Promoter: Hes1 promoter fragment (-467 to +46) (RBPj-)
• Tag / Fusion Protein:
  • Firefly luciferase (C terminal on backbone)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: F1ori-F (GTGGACTCTTGTTCCAAACTGG)
• 3′ sequencing primer: LucNrev

Resource Information

• A portion of this plasmid was derived from a plasmid made by: PGL2-Basic (under designation "Picagene Basic Vector") obtained from Toyo Ink (Tokyo, Japan).
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Alternate plasmid name: Hes1/RBP-J (-)

This construct contains the murine Hes1 promoter lacking the RBP-J site.

Relevant sequence portion:
WT: -86 /TGTGGGAAAGAAAGTTTGGGAAGTTT/ -61
Rbp J(-): -86 /TGTG[CTGC]AGAAAgtTT[CTCG]AGTTT/ -61 (mutated sequences are bracketed)

In Rbp J(-), PstI (CTGCAG) and XhoI (CTCGAG) sites are introduced.

Addgene quality control discovered a 2-base deletion (lower case letters) in the murine Hes1 promoter. This should not affect the function, and the vector is OK.