HBR-6U
(Plasmid #42621)

• Depositing Lab: Hannele RuoholaBaker
• Publication: Zhou et al PLoS One. 2011;6(11):e27460. doi: 10.1371/journal.pone.0027460. Epub 2011 Nov 23.

Backbone

• Vector backbone: pRRL-cPPT-X-PRE-SIN
• Backbone manufacturer: William Osborne
• Vector type: Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: 6 x HIF binding element
• Species: Synthetic
• Insert Size (bp): 315
• Tag / Fusion Protein:
  • eYFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: ClaI (unknown if destroyed)
• 3′ cloning site: XhoI (destroyed during cloning)
• 5′ sequencing primer: CAGTGCAGGGGAAAGAATAGTAG

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

HIF reporter construct was generated with HIF1α consensus binding site CGTG followed HIF2α site TACGTG together as one unit of binding site for HIFα factors and repeated them in tandem 6 times (HBR-6U), with 5 base pairs of nucleotides of various combinations spacing between. Induction element CACAG, a DNA element necessary for hypoxic induction, was evenly inserted into the whole sequences three times to assist in the induction process.