Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

HBR-6U
(Plasmid #42621)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 42621 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pRRL-cPPT-X-PRE-SIN
  • Backbone manufacturer
    William Osborne
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    6 x HIF binding element
  • Species
    Synthetic
  • Insert Size (bp)
    315
  • Tag / Fusion Protein
    • eYFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site ClaI (unknown if destroyed)
  • 3′ cloning site XhoI (destroyed during cloning)
  • 5′ sequencing primer CAGTGCAGGGGAAAGAATAGTAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

HIF reporter construct was generated with HIF1α consensus binding site CGTG followed HIF2α site TACGTG together as one unit of binding site for HIFα factors and repeated them in tandem 6 times (HBR-6U), with 5 base pairs of nucleotides of various combinations spacing between. Induction element CACAG, a DNA element necessary for hypoxic induction, was evenly inserted into the whole sequences three times to assist in the induction process.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    HBR-6U was a gift from Hannele RuoholaBaker (Addgene plasmid # 42621 ; http://n2t.net/addgene:42621 ; RRID:Addgene_42621)
  • For your References section:

    Assessment of hypoxia inducible factor levels in cancer cell lines upon hypoxic induction using a novel reporter construct. Zhou W, Dosey TL, Biechele T, Moon RT, Horwitz MS, Ruohola-Baker H. PLoS One. 2011;6(11):e27460. doi: 10.1371/journal.pone.0027460. Epub 2011 Nov 23. 10.1371/journal.pone.0027460 PubMed 22132102