ankG-mCherry
(Plasmid #42566)

• Depositing Lab: Benedicte Dargent
• Publication: Leterrier et al Proc Natl Acad Sci U S A. 2011 May 24;108(21):8826-31. doi: 10.1073/pnas.1018671108. Epub 2011 May 6.

Backbone

• Vector backbone: pEGFP-N1
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 4000
• Total vector size (bp): 12500
• Modifications to backbone: eGFP replaced by mCherry (Sal I / Not I)
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: ankyrin G
• Alt name: ANK3
• Species: R. norvegicus (rat)
• Insert Size (bp): 8500
• GenBank ID:
• Entrez Gene: Ank3 (a.k.a. ANK-3)
• Promoter: CMV
• Tag / Fusion Protein:
  • mCherry (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: SalI (not destroyed)
• 5′ sequencing primer: GATTTCCAAGTCTCCACC
• 3′ sequencing primer: GACAAACCACAACTAGAATGCAG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Vann Bennett, Duke University, Durham, North Carolina, USA
• Articles Citing this Plasmid:
  • 4 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry