-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 42513 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLHCX
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 6800
- Total vector size (bp) 8400
-
Vector typeRetroviral
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namePyruvate Kinase M2 Cys358->Ser
-
Alt namePKM2 C358S mutant
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1600
-
MutationChanged Cysteine 358 to Serine
- Promoter CMV
-
Tag
/ Fusion Protein
- Flag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HpaI (not destroyed)
- 3′ cloning site ClaI (not destroyed)
- 5′ sequencing primer AGCTCGTTTAGTGAACCGTCAGATC
- 3′ sequencing primer ACCTACAGGTGGGGTCTTTCATTCCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Changed Cys358 codon to Ser358 by 2-step PCR mutagenesis using pLHCX-FT-PKM2 as template
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLHCX-Flag-mPKM2(C358S) was a gift from Dimitrios Anastasiou (Addgene plasmid # 42513 ; http://n2t.net/addgene:42513 ; RRID:Addgene_42513) -
For your References section:
Inhibition of pyruvate kinase M2 by reactive oxygen species contributes to cellular antioxidant responses. Anastasiou D, Poulogiannis G, Asara JM, Boxer MB, Jiang JK, Shen M, Bellinger G, Sasaki AT, Locasale JW, Auld DS, Thomas CJ, Vander Heiden MG, Cantley LC. Science. 2011 Dec 2;334(6060):1278-83. doi: 10.1126/science.1211485. Epub 2011 Nov 3. 10.1126/science.1211485 PubMed 22052977