pLHCX-Flag-mPKM1
(Plasmid #42511)

• Depositing Lab: Dimitrios Anastasiou
• Publication: Anastasiou et al Science. 2011 Dec 2;334(6060):1278-83. doi: 10.1126/science.1211485. Epub 2011 Nov 3.

Backbone

• Vector backbone: pLHCX
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 6800
• Total vector size (bp): 8400
• Vector type: Retroviral
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Pyruvate Kinase M1
• Alt name: PKM1
• Species: M. musculus (mouse)
• Insert Size (bp): 1600
• Promoter: CMV
• Tag / Fusion Protein:
  • Flag (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HpaI (not destroyed)
• 3′ cloning site: ClaI (not destroyed)
• 5′ sequencing primer: AGCTCGTTTAGTGAACCGTCAGATC
• 3′ sequencing primer: ACCTACAGGTGGGGTCTTTCATTCCC

Resource Information

• Supplemental Documents:
  • PKM alignments
• A portion of this plasmid was derived from a plasmid made by: Lewis C. Cantley, Heather R. Christofk, Matthew G. Vander Heiden
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Plasmid constructed by Heather Christofk in Lew Cantley's Lab. Ref: Christofk, H. R., Vander Heiden, M. G., Harris, M. H., Ramanathan, A., Gerszten, R. E., Wei, R., Fleming, M. D., et al. (2008). The M2 splice isoform of pyruvate kinase is important for cancer metabolism and tumour growth. Nature, 452(7184), 230–233. doi:10.1038/nature06734

The depositing scientist notes: NM_011099.3 is PKM2 and NM_001253883.1 is PKM1, based on sequence homology of the respective translated products to the human PKM isoforms. The isoform annotations in the corresponding GeneBank entries are incorrect.