pMALp2x-SCO5461(E164D)(43-204)
(Plasmid #42508)

• Depositing Lab: Koji Okamoto
• Publication: Nakano et al Toxicon. 2012 Dec 2;63C:55-63. doi: 10.1016/j.toxicon.2012.11.019.

Backbone

• Vector backbone: pMAL-p2x
• Backbone manufacturer: New England Biolabs
• Backbone size w/o insert (bp): 6715
• Total vector size (bp): 7330
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): JM109
• Growth instructions: Use rich media (terrific broth, etc.) for protein expression.
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: guanosine ADP-ribosyltransferase
• Alt name: SCO5461
• Alt name: ScARP
• Alt name: NAD+:guanine-N2-ADP-D-ribosyltransferase
• Species: Streptomyces coelicolor A3(2)
• Insert Size (bp): 489
• Mutation: Deleted amino acids 1-42 (nucleotide 1-126); changed Glutamic acid 164 to Aspartic acid (guanosine 492 to cytosine)
• GenBank ID: AL939123.1:267130..267744 CAB76015.1
• Entrez Gene: SCO5461 (a.k.a. SCO5461, SC3D11.18)
• Promoter: tac
• Tag / Fusion Protein:
  • maltose-binding protein (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XbaI (not destroyed)
• 3′ cloning site: PstI (not destroyed)
• 5′ sequencing primer: ggtcgtcagactgtcgatgaagcc
• 3′ sequencing primer: gtaaaacgacggccag

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry