pcDNA3-GI-ZFP2
(Plasmid #42215)

• Purpose: Expresses GI-ZFP2 for light-inducible activation of gene expression
• Depositing Lab: Charles Gersbach
• Publication: Polstein et al J Am Chem Soc. 2012 Oct 10;134(40):16480-3. doi: 10.1021/ja3065667. Epub 2012 Sep 27.

Backbone

• Vector backbone: pcDNA3
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 5334
• Total vector size (bp): 9276
• Modifications to backbone: ZFP2 was inserted into the GI-ZFP1 plasmid using the NotI and XbaI sites to create the GI-FLAG-ZFP2 gene. The FLAG tag was then inserted using the NotI site.

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: GIGANTEA-FLAG-ZFP2
• Alt name: GI-FLAG-ZFP2
• Alt name: GI-ZFP2
• Alt name: GI
• Species: A. thaliana (mustard weed), Synthetic
• Insert Size (bp): 3942
• Entrez Gene: GI (a.k.a. AT1G22770, FB, GIGANTEA, T22J18.6, T22J18_6)
• Promoter: CMV
• Tag / Fusion Protein:
  • FLAG (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NotI (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: ATTGACGCAAATGGGCGGTAGGCGTGT
• 3′ sequencing primer: GCC TGC TAT TGT CTT CCC AAT

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry