-
PurposeLuciferase reporter for GI-ZFP2
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 42214 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepGL3-Basic
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 4859
- Total vector size (bp) 5026
-
Vector typeMammalian Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name9xSeq2 Binding Sites
-
Insert Size (bp)159
- Promoter 9 tandem copies of Seq2 + minimal human CMV promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site BglII (not destroyed)
- 5′ sequencing primer CAGGTGCCAGAACATTTCTCT
- 3′ sequencing primer GAGCTCTGCTTATATAGACCTCCC (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Binding site is AAACTGCAAAAG
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGL3-Basic-9xSeq2-Luc was a gift from Charles Gersbach (Addgene plasmid # 42214 ; http://n2t.net/addgene:42214 ; RRID:Addgene_42214) -
For your References section:
Light-inducible spatiotemporal control of gene activation by customizable zinc finger transcription factors. Polstein LR, Gersbach CA. J Am Chem Soc. 2012 Oct 10;134(40):16480-3. doi: 10.1021/ja3065667. Epub 2012 Sep 27. 10.1021/ja3065667 PubMed 22963237