-
PurposePeroxide-insensitive version of HyPer to be used as a pH-control. Can be applied as a pH sensor.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 42213 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepC1
- Backbone size w/o insert (bp) 3982
- Total vector size (bp) 5419
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHYPER C199S
-
Alt nameSYPHER
-
SpeciesSynthetic
-
Insert Size (bp)1437
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer cggtgggaggtctatataag
- 3′ sequencing primer tgggaggttttttaaagcaag (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pC1-HyPer-C199S was a gift from Vsevolod Belousov (Addgene plasmid # 42213 ; http://n2t.net/addgene:42213 ; RRID:Addgene_42213) -
For your References section:
Genetically encoded fluorescent indicator for intracellular hydrogen peroxide. Belousov VV, Fradkov AF, Lukyanov KA, Staroverov DB, Shakhbazov KS, Terskikh AV, Lukyanov S. Nat Methods. 2006 Apr;3(4):281-6. 10.1038/nmeth866 PubMed 16554833