-
PurposeGenetically encoded fluorescent indicator for simultaneous PIP3 and hydrogen peroxide detection.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 42212 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepC1
- Backbone size w/o insert (bp) 3931
- Total vector size (bp) 5896
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePIP-SHOW
-
Alt nameBTK-HYPER
-
SpeciesSynthetic
-
Insert Size (bp)1965
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer cggtgggaggtctatataag
- 3′ sequencing primer tgggaggttttttaaagcaag (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pC1-PIP-SHOW was a gift from Vsevolod Belousov (Addgene plasmid # 42212 ; http://n2t.net/addgene:42212 ; RRID:Addgene_42212) -
For your References section:
Can we see PIP(3) and hydrogen peroxide with a single probe?. Mishina NM, Bogeski I, Bolotin DA, Hoth M, Niemeyer BA, Schultz C, Zagaynova EV, Lukyanov S, Belousov VV. Antioxid Redox Signal. 2012 Aug 1;17(3):505-12. doi: 10.1089/ars.2012.4574. Epub 2012 Apr 10. 10.1089/ars.2012.4574 PubMed 22369174