pTorPE-GR-GECO1.2
(Plasmid
#42199)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 42199 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepTorPE
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 4100
- Total vector size (bp) 5300
-
Modifications to backboneThe TorA protein export plasmid (pTorPE) was constructed by inserting a digested DNA fragment encoding TorA-6×His-GCaMP3-SsrA into the NcoI/HindII sites of pBAD/His B (Invitrogen).
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH10B
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameGR-GECO1.2
-
Alt namegreen-to-red photoconvertible Ca2+ indicator
-
SpeciesSynthetic
-
Insert Size (bp)1245
- Promoter araBAD
-
Tag
/ Fusion Protein
- 6His (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer ATGCCATAGCATTTTTATCC
- 3′ sequencing primer GATTTAATCTGTATCAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTorPE-GR-GECO1.2 was a gift from Robert Campbell (Addgene plasmid # 42199 ; http://n2t.net/addgene:42199 ; RRID:Addgene_42199) -
For your References section:
Highlightable Ca(2+) Indicators for Live Cell Imaging. Hoi H, Matsuda T, Nagai T, Campbell RE. J Am Chem Soc. 2012 Dec 26. 10.1021/ja310184a PubMed 23256581