pTorPE-GR-GECO1.2
(Plasmid #42199)

• Depositing Lab: Robert Campbell
• Publication: Hoi et al J Am Chem Soc. 2012 Dec 26.

Backbone

• Vector backbone: pTorPE
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 4100
• Total vector size (bp): 5300
• Modifications to backbone: The TorA protein export plasmid (pTorPE) was constructed by inserting a digested DNA fragment encoding TorA-6×His-GCaMP3-SsrA into the NcoI/HindII sites of pBAD/His B (Invitrogen).
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH10B
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: GR-GECO1.2
• Alt name: green-to-red photoconvertible Ca2+ indicator
• Species: Synthetic
• Insert Size (bp): 1245
• Promoter: araBAD
• Tag / Fusion Protein:
  • 6His (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XbaI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: ATGCCATAGCATTTTTATCC
• 3′ sequencing primer: GATTTAATCTGTATCAGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry