-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 42187 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonemodified pcDNA3.1
- Backbone size w/o insert (bp) 3200
- Total vector size (bp) 4500
-
Modifications to backboneThe SV40 promoter, the SV40 origin of replication, the Neomycin ORF, and the SV40 poly A region in the original pcDNA3.1 was deleted.
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH10B
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGR-GECO1.2
-
Alt namegreen-to-red photoconvertible Ca2+ indicator
-
SpeciesSynthetic
-
Insert Size (bp)1260
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV-GR-GECO1.2 was a gift from Robert Campbell (Addgene plasmid # 42187 ; http://n2t.net/addgene:42187 ; RRID:Addgene_42187) -
For your References section:
Highlightable Ca(2+) Indicators for Live Cell Imaging. Hoi H, Matsuda T, Nagai T, Campbell RE. J Am Chem Soc. 2012 Dec 26. 10.1021/ja310184a PubMed 23256581