-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 42175 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepcDNA3.1/CT-GFP TOPO
-
Backbone manufacturerinvitrogen
- Backbone size w/o insert (bp) 6157
- Total vector size (bp) 7828
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameInsulin-like growth factor 2 mRNA binding protein 2-2
-
Alt nameIMP2-2, p62, IGF2BP2-2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1671
-
GenBank IDNM_001007225.1
-
Entrez GeneIGF2BP2 (a.k.a. IMP-2, IMP2, VICKZ2)
- Promoter T7
-
Tag
/ Fusion Protein
- GFP (C terminal on insert)
Cloning Information
- Cloning method TOPO Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GGGTAAGCTTTCCGTATGTAGC (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3-GFP-IMP2-2 was a gift from Alexandra Kiemer (Addgene plasmid # 42175 ; http://n2t.net/addgene:42175 ; RRID:Addgene_42175) -
For your References section:
IGF2 mRNA binding protein p62/IMP2-2 in hepatocellular carcinoma: antiapoptotic action is independent of IGF2/PI3K signaling. Kessler SM, Pokorny J, Zimmer V, Laggai S, Lammert F, Bohle RM, Kiemer AK. Am J Physiol Gastrointest Liver Physiol. 2013 Feb 15;304(4):G328-36. doi: 10.1152/ajpgi.00005.2012. Epub 2012 Dec 20. 10.1152/ajpgi.00005.2012 PubMed 23257922