Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pcDNA3-GFP-IMP2-2_antisense-control
(Plasmid #42174)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 42174 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pcDNA3.1/CT-GFP TOPO
  • Backbone manufacturer
    invitrogen
  • Backbone size w/o insert (bp) 6157
  • Total vector size (bp) 7828
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Insulin-like growth factor 2 mRNA binding protein 2-2 antisense control
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1671
  • GenBank ID
    NM_001007225.1
  • Entrez Gene
    IGF2BP2 (a.k.a. IMP-2, IMP2, VICKZ2)
  • Promoter T7
  • Tag / Fusion Protein
    • GFP (C terminal on insert)

Cloning Information

  • Cloning method TOPO Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GGGTAAGCTTTCCGTATGTAGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3-GFP-IMP2-2_antisense-control was a gift from Alexandra Kiemer (Addgene plasmid # 42174 ; http://n2t.net/addgene:42174 ; RRID:Addgene_42174)
  • For your References section:

    IGF2 mRNA binding protein p62/IMP2-2 in hepatocellular carcinoma: antiapoptotic action is independent of IGF2/PI3K signaling. Kessler SM, Pokorny J, Zimmer V, Laggai S, Lammert F, Bohle RM, Kiemer AK. Am J Physiol Gastrointest Liver Physiol. 2013 Feb 15;304(4):G328-36. doi: 10.1152/ajpgi.00005.2012. Epub 2012 Dec 20. 10.1152/ajpgi.00005.2012 PubMed 23257922