Skip to main content
Addgene

pmAmetrine1.2
(Plasmid #42171)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 42171 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pBAD-His B
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 4100
  • Total vector size (bp) 4800
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH10B
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    mAmetrine1.2
  • Species
    Synthetic
  • Insert Size (bp)
    720
  • Promoter araBAD
  • Tag / Fusion Protein
    • 6His (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer GGTCCCCTCTCTACTGTTTCTCCAT
  • 3′ sequencing primer CCCAAGGCGTTTCACTTCTGAGTT
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    mAmetrine1.2 in an intensively engineered variant of GFP.
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pmAmetrine1.2 was a gift from Robert Campbell (Addgene plasmid # 42171 ; http://n2t.net/addgene:42171 ; RRID:Addgene_42171)
  • For your References section:

    Forster resonance energy transfer-based biosensors for multiparameter ratiometric imaging of Ca2+ dynamics and caspase-3 activity in single cells. Ding Y, Ai HW, Hoi H, Campbell RE. Anal Chem. 2011 Dec 15;83(24):9687-93. doi: 10.1021/ac202595g. Epub 2011 Nov 28. 10.1021/ac202595g PubMed 22080726