-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 42171 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepBAD-His B
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 4100
- Total vector size (bp) 4800
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH10B
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namemAmetrine1.2
-
SpeciesSynthetic
-
Insert Size (bp)720
- Promoter araBAD
-
Tag
/ Fusion Protein
- 6His (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer GGTCCCCTCTCTACTGTTTCTCCAT
- 3′ sequencing primer CCCAAGGCGTTTCACTTCTGAGTT (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bymAmetrine1.2 in an intensively engineered variant of GFP.
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pmAmetrine1.2 was a gift from Robert Campbell (Addgene plasmid # 42171 ; http://n2t.net/addgene:42171 ; RRID:Addgene_42171) -
For your References section:
Forster resonance energy transfer-based biosensors for multiparameter ratiometric imaging of Ca2+ dynamics and caspase-3 activity in single cells. Ding Y, Ai HW, Hoi H, Campbell RE. Anal Chem. 2011 Dec 15;83(24):9687-93. doi: 10.1021/ac202595g. Epub 2011 Nov 28. 10.1021/ac202595g PubMed 22080726