Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pcpmAmetrine
(Plasmid #42170)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 42170 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pBAD-His B
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 4100
  • Total vector size (bp) 4800
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH10B
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    cpmAmetrine173
  • Species
    Synthetic
  • Insert Size (bp)
    729
  • Promoter araBAD
  • Tag / Fusion Protein
    • 6His (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer GGTCCCCTCTCTACTGTTTCTCCAT
  • 3′ sequencing primer CCCAAGGCGTTTCACTTCTGAGTT
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    cpmAmetrine173 in an intensively engineered variant of GFP.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcpmAmetrine was a gift from Robert Campbell (Addgene plasmid # 42170 ; http://n2t.net/addgene:42170 ; RRID:Addgene_42170)
  • For your References section:

    Forster resonance energy transfer-based biosensors for multiparameter ratiometric imaging of Ca2+ dynamics and caspase-3 activity in single cells. Ding Y, Ai HW, Hoi H, Campbell RE. Anal Chem. 2011 Dec 15;83(24):9687-93. doi: 10.1021/ac202595g. Epub 2011 Nov 28. 10.1021/ac202595g PubMed 22080726