pQE-30-HyPer3
(Plasmid #42132)

• Purpose: Genetically encoded H2O2 probe for ratiometric and fluorescence lifetime imaging
• Depositing Lab: Vsevolod Belousov
• Publication: Bilan et al ACS Chem Biol. 2012 Dec 20.

Backbone

• Vector backbone: pQE-30
• Backbone size w/o insert (bp): 3425
• Total vector size (bp): 4859
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): XL1 Blue
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: HYPER 3
• Species: Synthetic
• Insert Size (bp): 1434
• Promoter: T5
• Tag / Fusion Protein:
  • 6His (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: aggagaaattaactatgagagg
• 3′ sequencing primer: ccagatggagttctgaggtc

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry