Skip to main content
Addgene

pC1-HyPer-3
(Plasmid #42131)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 42131 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pC1
  • Backbone size w/o insert (bp) 3982
  • Total vector size (bp) 5419
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    HYPER 3
  • Species
    Synthetic
  • Insert Size (bp)
    1437
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer cggtgggaggtctatataag
  • 3′ sequencing primer tgggaggttttttaaagcaag
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pC1-HyPer-3 was a gift from Vsevolod Belousov (Addgene plasmid # 42131 ; http://n2t.net/addgene:42131 ; RRID:Addgene_42131)

  • For your References section:

    HyPer-3: a genetically encoded H2O2 probe with improved performance for ratiometric and fluorescence lifetime imaging. Bilan DS, Pase L, Joosen L, Gorokhovatsky AY, Ermakova YG, Gadella TW, Grabher C, Schultz C, Lukyanov S, Belousov VV. ACS Chem Biol. 2012 Dec 20. 10.1021/cb300625g PubMed 23256573
Related items:
Commonly requested with: