pLuc-CDS
(Plasmid #42100)

• Depositing Lab: Kumiko Ui-Tei
• Publication: Mazda et al PLoS One. 2011;6(12):e28688. doi: 10.1371/journal.pone.0028688. Epub 2011 Dec 21.

Backbone

• Vector backbone: psiCHECK-1
• Backbone manufacturer: Promega
• Backbone size w/o insert (bp): 3565
• Total vector size (bp): 6940
• Modifications to backbone: The stop codon of Renilla luciferase was removed, and a SalI restriction site was added by PCR.
• Vector type: Mammalian Expression, Luciferase

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: ZEB1
• Species: H. sapiens (human)
• GenBank ID: NM_030751.4
• Entrez Gene: ZEB1 (a.k.a. AREB6, BZP, DELTAEF1, FECD6, NIL2A, PPCD3, TCF8, ZFHEP, ZFHX1A)
• Promoter: SV40
• Tag / Fusion Protein:
  • Renilla luciferase (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SalI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: CGCAACTACAACGCCTACCT

Resource Information

• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Renilla Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry