proE-cad670-Luc
(Plasmid #42083)

• Depositing Lab: Kumiko Ui-Tei
• Publication: Mazda et al PLoS One. 2011;6(12):e28688. doi: 10.1371/journal.pone.0028688. Epub 2011 Dec 21.

Backbone

• Vector backbone: pGL3-Basic
• Backbone manufacturer: Promega
• Backbone size w/o insert (bp): 4807
• Total vector size (bp): 5569
• Vector type: Mammalian Expression, Luciferase

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: E-cadherin
• Alt name: CDH1
• Species: H. sapiens (human)
• Insert Size (bp): 762
• Mutation: contains E-cadherin promoter region from -670 to +92
• GenBank ID: NM_004360
• Entrez Gene: CDH1 (a.k.a. Arc-1, BCDS1, CD324, CDHE, ECAD, LCAM, UVO)
• Promoter: E-cadherin

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BglII (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: CTAGCAAAATAGGCTGTCCC

Resource Information

• Articles Citing this Plasmid:
  • 4 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry