Skip to main content
Addgene

pmyc-GFP
(Plasmid #42028)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 42028 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pcDNA3.1
  • Backbone size w/o insert (bp) 5338
  • Total vector size (bp) 6106
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    EGFP
  • GenBank ID
  • Promoter CMV
  • Tag / Fusion Protein
    • Myc (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pmyc-GFP was a gift from Kumiko Ui-Tei (Addgene plasmid # 42028 ; http://n2t.net/addgene:42028 ; RRID:Addgene_42028)
  • For your References section:

    Human TNRC6A is an Argonaute-navigator protein for microRNA-mediated gene silencing in the nucleus. Nishi K, Nishi A, Nagasawa T, Ui-Tei K. RNA. 2013 Jan;19(1):17-35. doi: 10.1261/rna.034769.112. Epub 2012 Nov 13. 10.1261/rna.034769.112 PubMed 23150874