KaiC
(Plasmid #41884)

• Depositing Lab: Michael Rust
• Publication: Phong et al Proc Natl Acad Sci U S A. 2013 Jan 15;110(3):1124-9. doi: 10.1073/pnas.1212113110. Epub 2012 Dec 31.

Backbone

• Vector backbone: prset-B
• Backbone manufacturer: invitrogen
• Backbone size w/o insert (bp): 2200
• Total vector size (bp): 2700
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: Growth instructions for expression of Kai C is grown in TB for 2 days at 25C
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Kai C
• Species: Synthetic; cyanobacteria
• Insert Size (bp): 1528
• GenBank ID: CP000100
• Promoter: t7
• Tag / Fusion Protein:
  • histadine (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: BglII (not destroyed)
• 5′ sequencing primer: cgacgtggatccgggactggaagttctgttccaggggcccatgacttccgctgagatgactagcc
• 3′ sequencing primer: gttctttttcccggcctctcgatttctagatggagg

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Plasmid originally cloned in Rust et al., Science, 318, 809-812 (2007).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry