Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pJN105-Hygro-GFP
(Plasmid #41883)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 41883 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pJN105
  • Backbone size w/o insert (bp) 6050
  • Modifications to backbone
    Gentamicin resistance cassette replaced with hygromycin resistance fragment from pMV206.hygro
  • Vector type
    Bacterial Expression ; Bacterial broad host range vector
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Hygromycin, 200 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Ptac::GFP-mut-2
  • Alt name
    GFP-mut-2
  • Alt name
    GFP
  • Species
    A. victoria
  • Mutation
    GFP-mut-2 is GFP with Ser65Ala, Val68Leu, and Ser72Ala
  • Promoter Ptac

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer pBAD-F (ATGCCATAGCATTTTTATCC)
  • 3′ sequencing primer M13_pUC_fwd
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    HygroR gene obtained by PC from pMV206.hygro, from William Jacobs, Jr., Albert Einstein College of Medicine, Bronx, New York. Ptac::GFP-mut-2 obtained by PCR from pGS-GFP04 from Howard Shuman, University of Chicago, Chicago, Illinois. (PMID: 11722729)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The pBBR1MCS-5 derivative of the Bordetella bronchiseptica BHR plasmid has a pBBR/BHR replicon that is maintained in L. pneumophila and is compatible with IncP, IncW, IncQ, and IncRi incompatibility groups. Plasmid pJN105 is a derivative of pBBR1MCS-5 with araC and PBAD regions before the polylinker. PCR primers with BglII sites at their 5′ ends were used to amplify the region outside the gentamicin cassette in pJN105. The PCR fragment was digested with BglII, blunted with the Klenow fragment, and ligated to the blunted DdeI-DdeI hygromycin resistance fragment from pMV206.hygro to form pJN105-hygro. The Ptac-GFP fragment of pGS-GFP04 was amplified by PCR by using primers with NheI sites at their 5′ ends. After digestion with NheI, this fragment was ligated with NheI-digested pJN105-hygro to form pJN105-hygro-GFP.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJN105-Hygro-GFP was a gift from Howard Steinman (Addgene plasmid # 41883 ; http://n2t.net/addgene:41883 ; RRID:Addgene_41883)
  • For your References section:

    Icm/dot-independent entry of Legionella pneumophila into amoeba and macrophage hosts. Bandyopadhyay P, Xiao H, Coleman HA, Price-Whelan A, Steinman HM. Infect Immun. 2004 Aug;72(8):4541-51. 10.1128/IAI.72.8.4541-4551.2004 PubMed 15271914