psiCheck-DNAJA4CDS
(Plasmid #41849)

• Depositing Lab: Sohail Tavazoie
• Publication: Pencheva et al Cell. 2012 Nov 21;151(5):1068-82. doi: 10.1016/j.cell.2012.10.028. Epub 2012 Nov 8.

Backbone

• Vector backbone: PsiCheck2
• Backbone manufacturer: Promega
• Backbone size w/o insert (bp): 6273
• Total vector size (bp): 6400
• Modifications to backbone: The CDS of DNAJA4 is chimerically fused to the C terminus of the renilla luciferase reporter in the psiCheck2 vector by removing the luciferase stop codon and inserting a 6 amino acid-long linker connecting the CDS of luciferase to the CDS of DNAJA4.
• Vector type: Luciferase

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: DNAJA4 CDS
• Species: H. sapiens (human)
• Insert Size (bp): 1100
• Mutation: Start codon of DNAJA4 removed
• GenBank ID: NM_001130183
• Entrez Gene: DNAJA4 (a.k.a. MST104, MSTP104, PRO1472)
• Tag / Fusion Protein:
  • renilla luciferase (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: GTACATCAAGAGCTTCGTGG
• 3′ sequencing primer: AAGACTCATTTAGATCCTCACAC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Renilla Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry