Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

psiCheck-DNAJA43'UTR
(Plasmid #41847)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 41847 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    psiCheck2
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 6200
  • Total vector size (bp) 9000
  • Vector type
    Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    DNAJA4 3'UTR
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1736
  • GenBank ID
    NM_001130183
  • Entrez Gene
    DNAJA4 (a.k.a. MST104, MSTP104, PRO1472)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Xho1 (not destroyed)
  • 3′ cloning site No1 (not destroyed)
  • 5′ sequencing primer GTACATCAAGAGCTTCGTGG
  • 3′ sequencing primer AAGACTCATTTAGATCCTCACAC
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Full-length 3′UTR of DNAJA4 was cloned downstream of a renilla luciferase reporter into the psiCheck2 dual luciferase reporter vector

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    psiCheck-DNAJA43'UTR was a gift from Sohail Tavazoie (Addgene plasmid # 41847 ; http://n2t.net/addgene:41847 ; RRID:Addgene_41847)
  • For your References section:

    Convergent Multi-miRNA Targeting of ApoE Drives LRP1/LRP8-Dependent Melanoma Metastasis and Angiogenesis. Pencheva N, Tran H, Buss C, Huh D, Drobnjak M, Busam K, Tavazoie SF. Cell. 2012 Nov 21;151(5):1068-82. doi: 10.1016/j.cell.2012.10.028. Epub 2012 Nov 8. 10.1016/j.cell.2012.10.028 PubMed 23142051